ID: 950189741_950189745

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 950189741 950189745
Species Human (GRCh38) Human (GRCh38)
Location 3:10968409-10968431 3:10968428-10968450
Sequence CCACTTACTTTAATGGAGAGACA GACAAGGGGCAAGAGTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140} {0: 1, 1: 0, 2: 3, 3: 19, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!