ID: 950217304_950217306

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 950217304 950217306
Species Human (GRCh38) Human (GRCh38)
Location 3:11168734-11168756 3:11168759-11168781
Sequence CCCAGGGCTGGGGGTGCGGGCTG TGTAAAGAACTCCTCTAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 131, 4: 1019} {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!