ID: 950223202_950223206

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 950223202 950223206
Species Human (GRCh38) Human (GRCh38)
Location 3:11212445-11212467 3:11212479-11212501
Sequence CCATCTGGGGCAGGCCTGGAAAA AATCCAGGTAGAGGACCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 233} {0: 1, 1: 0, 2: 1, 3: 11, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!