ID: 950230906_950230913

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 950230906 950230913
Species Human (GRCh38) Human (GRCh38)
Location 3:11275024-11275046 3:11275061-11275083
Sequence CCAGGTGACAGGATGAAGATCTG CAGTGGAGATGGAGAGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 382} {0: 1, 1: 6, 2: 21, 3: 149, 4: 849}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!