ID: 950243125_950243126

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 950243125 950243126
Species Human (GRCh38) Human (GRCh38)
Location 3:11389546-11389568 3:11389559-11389581
Sequence CCATCATACTAAAACGGGAAAAT ACGGGAAAATACCGCCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 228} {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!