ID: 950251438_950251445

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 950251438 950251445
Species Human (GRCh38) Human (GRCh38)
Location 3:11468914-11468936 3:11468932-11468954
Sequence CCTCTGGCCCTCCAGGCTGTGTG GTGTGTGGGCAGATTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 685} {0: 1, 1: 0, 2: 4, 3: 44, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!