ID: 950253090_950253104

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 950253090 950253104
Species Human (GRCh38) Human (GRCh38)
Location 3:11483181-11483203 3:11483220-11483242
Sequence CCCGTCCCCCTGCCCCTAACCCA AGTGATATCCCCATCCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 118, 4: 1888} {0: 1, 1: 1, 2: 1, 3: 9, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!