ID: 950266231_950266246

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950266231 950266246
Species Human (GRCh38) Human (GRCh38)
Location 3:11575163-11575185 3:11575213-11575235
Sequence CCTTGCTCCCCTGCTGCCAATGC CTGTGGTGCGAGAGGGAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 327} {0: 1, 1: 0, 2: 1, 3: 31, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!