ID: 950284488_950284493

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 950284488 950284493
Species Human (GRCh38) Human (GRCh38)
Location 3:11733931-11733953 3:11733964-11733986
Sequence CCAGAGTTCATTGCATGACCCTC AAGCAGATGGAGAAAGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!