ID: 950294609_950294615

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 950294609 950294615
Species Human (GRCh38) Human (GRCh38)
Location 3:11818164-11818186 3:11818187-11818209
Sequence CCTTTGTTGGAGAGGGAGCAAAT TGTCAGGGGGAGTAGAGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 204} {0: 1, 1: 0, 2: 1, 3: 46, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!