ID: 950322462_950322466

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 950322462 950322466
Species Human (GRCh38) Human (GRCh38)
Location 3:12069761-12069783 3:12069790-12069812
Sequence CCTACTGGGTGTGATTTGGTACC TTGTTTATTTGTTTTGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 445} {0: 1, 1: 44, 2: 227, 3: 1910, 4: 21778}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!