ID: 950396456_950396460

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 950396456 950396460
Species Human (GRCh38) Human (GRCh38)
Location 3:12737746-12737768 3:12737779-12737801
Sequence CCACTTCTCCTTAAGAACAAGAG ATTTAACTTTGATGCAGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 194} {0: 1, 1: 0, 2: 0, 3: 17, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!