ID: 950407386_950407394

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 950407386 950407394
Species Human (GRCh38) Human (GRCh38)
Location 3:12813193-12813215 3:12813234-12813256
Sequence CCCACTCCTGTCCTGGCTGGATC CCTGCCCCACAGGTGCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 253} {0: 1, 1: 0, 2: 3, 3: 41, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!