ID: 950407390_950407394

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 950407390 950407394
Species Human (GRCh38) Human (GRCh38)
Location 3:12813215-12813237 3:12813234-12813256
Sequence CCAGCAAAGCATTCCTCATCCTG CCTGCCCCACAGGTGCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 203} {0: 1, 1: 0, 2: 3, 3: 41, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!