ID: 950424596_950424602

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 950424596 950424602
Species Human (GRCh38) Human (GRCh38)
Location 3:12918256-12918278 3:12918279-12918301
Sequence CCCTTCTTGGGAATGGGGTGCAC AGCCCCTTCCATGGGAAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 115} {0: 1, 1: 1, 2: 2, 3: 26, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!