ID: 950430392_950430404

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 950430392 950430404
Species Human (GRCh38) Human (GRCh38)
Location 3:12947612-12947634 3:12947651-12947673
Sequence CCTGCTCCTTCCCATGAGATGAG TGGGCCCCTGGTGGTGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 621} {0: 1, 1: 0, 2: 5, 3: 41, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!