ID: 950439556_950439558

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 950439556 950439558
Species Human (GRCh38) Human (GRCh38)
Location 3:13001292-13001314 3:13001311-13001333
Sequence CCTGTGCTGGCTTGTGGGCACTT ACTTGATAGATGCATGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174} {0: 1, 1: 0, 2: 2, 3: 19, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!