ID: 950441789_950441800

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950441789 950441800
Species Human (GRCh38) Human (GRCh38)
Location 3:13014836-13014858 3:13014886-13014908
Sequence CCACTCTGGATCATTTCAGAAAG GCTCCTGGGGGGACACATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 194} {0: 1, 1: 0, 2: 0, 3: 15, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!