ID: 950450065_950450075

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 950450065 950450075
Species Human (GRCh38) Human (GRCh38)
Location 3:13060464-13060486 3:13060499-13060521
Sequence CCAGCTCCTGCAGTCTCAGGGCC CTGGCTTTCCACCGATGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 50, 4: 457} {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!