ID: 950467503_950467514

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 950467503 950467514
Species Human (GRCh38) Human (GRCh38)
Location 3:13163816-13163838 3:13163869-13163891
Sequence CCAGCCCCAGAAAGGAAGGGACA CACTCTAAACACAGGGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!