ID: 950481710_950481721

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 950481710 950481721
Species Human (GRCh38) Human (GRCh38)
Location 3:13248193-13248215 3:13248231-13248253
Sequence CCTATTGTGTCCCCAAGGCCACT ACGTGGGTTCAGGAGGAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!