ID: 950500013_950500023

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 950500013 950500023
Species Human (GRCh38) Human (GRCh38)
Location 3:13357831-13357853 3:13357877-13357899
Sequence CCCCCACGCCTACTCTGACCCTA GCCCCATTTTAACACCCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181} {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!