ID: 950500014_950500023

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 950500014 950500023
Species Human (GRCh38) Human (GRCh38)
Location 3:13357832-13357854 3:13357877-13357899
Sequence CCCCACGCCTACTCTGACCCTAC GCCCCATTTTAACACCCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144} {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!