ID: 950507292_950507304

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 950507292 950507304
Species Human (GRCh38) Human (GRCh38)
Location 3:13403330-13403352 3:13403377-13403399
Sequence CCTGCTGTCTTCCCACTGTTGTC TCTCTGGGGCCTTTTGTATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 274} {0: 1, 1: 14, 2: 159, 3: 537, 4: 1229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!