ID: 950507838_950507842

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 950507838 950507842
Species Human (GRCh38) Human (GRCh38)
Location 3:13406752-13406774 3:13406769-13406791
Sequence CCTGCACACCTGTCCTTCTTCTC CTTCTCTGCACCTCAGCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 629} {0: 1, 1: 0, 2: 3, 3: 25, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!