ID: 950535015_950535018

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 950535015 950535018
Species Human (GRCh38) Human (GRCh38)
Location 3:13573573-13573595 3:13573596-13573618
Sequence CCGGCTCCTGTGCACATGCTGGG CACTCAGAAGCCACTGTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 305} {0: 1, 1: 0, 2: 3, 3: 14, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!