ID: 950572677_950572686

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 950572677 950572686
Species Human (GRCh38) Human (GRCh38)
Location 3:13811743-13811765 3:13811773-13811795
Sequence CCCAAGACACCCTCACCCGCCTG GCCCCCAGCAATGCACACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 10, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!