ID: 950573703_950573712

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 950573703 950573712
Species Human (GRCh38) Human (GRCh38)
Location 3:13817936-13817958 3:13817988-13818010
Sequence CCAGGCATCCAGGGGCAGCTTGT CAGCTGTGCAAGGGGCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 208} {0: 1, 1: 0, 2: 6, 3: 20, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!