ID: 950579369_950579372

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 950579369 950579372
Species Human (GRCh38) Human (GRCh38)
Location 3:13852534-13852556 3:13852548-13852570
Sequence CCCAATCGACAGATGTGGAAACT GTGGAAACTGAGGTCGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 368, 4: 2470} {0: 1, 1: 1, 2: 6, 3: 71, 4: 598}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!