ID: 950583908_950583915

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 950583908 950583915
Species Human (GRCh38) Human (GRCh38)
Location 3:13879829-13879851 3:13879855-13879877
Sequence CCGCCGGGGCCGCGGGCCGGGCT CTGATCCCGCGGGCCGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 381} {0: 1, 1: 0, 2: 1, 3: 5, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!