ID: 950590849_950590856

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 950590849 950590856
Species Human (GRCh38) Human (GRCh38)
Location 3:13934995-13935017 3:13935009-13935031
Sequence CCAGCGAGGAGGCCCCTGAGAAG CCTGAGAAGGAGGAACTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 162} {0: 1, 1: 1, 2: 8, 3: 61, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!