ID: 950602270_950602275

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 950602270 950602275
Species Human (GRCh38) Human (GRCh38)
Location 3:14045381-14045403 3:14045411-14045433
Sequence CCCGAATCCCTCTAATTACCATA GATCTCTCATATTTCCTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 137} {0: 1, 1: 1, 2: 2, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!