ID: 950618081_950618092

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 950618081 950618092
Species Human (GRCh38) Human (GRCh38)
Location 3:14178421-14178443 3:14178466-14178488
Sequence CCACCGGCGGCGTCTCCCGCGAA CCTCCTCCTCCTCCTCACGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 38} {0: 1, 1: 1, 2: 36, 3: 207, 4: 911}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!