ID: 950633259_950633269

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 950633259 950633269
Species Human (GRCh38) Human (GRCh38)
Location 3:14298078-14298100 3:14298104-14298126
Sequence CCCTGAACCTCCCTTTCCCAGTT GCCTAGGAATGCCGGCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 347} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!