ID: 950658493_950658500

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 950658493 950658500
Species Human (GRCh38) Human (GRCh38)
Location 3:14452134-14452156 3:14452158-14452180
Sequence CCTTCCTCCCTCTGTTTTCACAG GGAGGCAGCAGAGCAGCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 630} {0: 1, 1: 0, 2: 2, 3: 40, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!