ID: 950664510_950664524

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 950664510 950664524
Species Human (GRCh38) Human (GRCh38)
Location 3:14487138-14487160 3:14487190-14487212
Sequence CCATCTCCCCAGCGGGGGCTCCC GTAGGCAAATTGCAACATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 345} {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!