ID: 950670131_950670143

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 950670131 950670143
Species Human (GRCh38) Human (GRCh38)
Location 3:14521019-14521041 3:14521072-14521094
Sequence CCTTCTCCCCTCCTTAGCCACCA ACAGCTGCTGCCGCTTCCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 654} {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!