ID: 950681066_950681072

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 950681066 950681072
Species Human (GRCh38) Human (GRCh38)
Location 3:14585448-14585470 3:14585488-14585510
Sequence CCCATTTCACACGTAAAGGGCAG CCCATTAGGCCCCCACTTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!