ID: 950690870_950690874

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 950690870 950690874
Species Human (GRCh38) Human (GRCh38)
Location 3:14656369-14656391 3:14656392-14656414
Sequence CCTTTTGGTTGTCTGTTATGCCA TTAACGTTTTTAAAGGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136} {0: 1, 1: 0, 2: 2, 3: 14, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!