ID: 950703630_950703638

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 950703630 950703638
Species Human (GRCh38) Human (GRCh38)
Location 3:14766885-14766907 3:14766921-14766943
Sequence CCAGAGCTGTGGGAGGCTTTGAG CGGCTTTGAGGAGCGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 335} {0: 1, 1: 1, 2: 0, 3: 19, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!