ID: 950703963_950703965

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 950703963 950703965
Species Human (GRCh38) Human (GRCh38)
Location 3:14768707-14768729 3:14768725-14768747
Sequence CCAGGGGCTCAGAAATAGTGGGC TGGGCTAGCCGCAATACCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!