ID: 950719911_950719926

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 950719911 950719926
Species Human (GRCh38) Human (GRCh38)
Location 3:14875457-14875479 3:14875510-14875532
Sequence CCCAGAGGTAGGAAAAAATAGAG TGGCATGGAGGAGTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 54, 4: 345} {0: 1, 1: 1, 2: 3, 3: 46, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!