ID: 950722912_950722914

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 950722912 950722914
Species Human (GRCh38) Human (GRCh38)
Location 3:14897637-14897659 3:14897662-14897684
Sequence CCTGGAGGAGCTGGAGGAAAGGC TCAAATTGGTGAGCAGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 522} {0: 1, 1: 0, 2: 0, 3: 11, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!