ID: 950726142_950726148

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 950726142 950726148
Species Human (GRCh38) Human (GRCh38)
Location 3:14918303-14918325 3:14918347-14918369
Sequence CCAGGAGAGCTGAGAGAGGCACT TAGGCTCTTTACCATGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 314} {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!