ID: 950738929_950738932

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 950738929 950738932
Species Human (GRCh38) Human (GRCh38)
Location 3:15034193-15034215 3:15034220-15034242
Sequence CCTGCTTCAGTCTCGGATCCAGC AGCCTGCCTCCTGCCCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 168} {0: 1, 1: 0, 2: 5, 3: 64, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!