ID: 950761763_950761768

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 950761763 950761768
Species Human (GRCh38) Human (GRCh38)
Location 3:15236158-15236180 3:15236180-15236202
Sequence CCCTGTCTGAAAAAATAAAAAAT TTGTGAAAGGGGAAGAAAATAGG
Strand - +
Off-target summary {0: 4, 1: 158, 2: 1396, 3: 22578, 4: 44840} {0: 1, 1: 0, 2: 6, 3: 69, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!