|
Left Crispr |
Right Crispr |
| Crispr ID |
950761764 |
950761768 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:15236159-15236181
|
3:15236180-15236202
|
| Sequence |
CCTGTCTGAAAAAATAAAAAATT |
TTGTGAAAGGGGAAGAAAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 24, 2: 563, 3: 3441, 4: 27234} |
{0: 1, 1: 0, 2: 6, 3: 69, 4: 591} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|