ID: 950766042_950766052

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 950766042 950766052
Species Human (GRCh38) Human (GRCh38)
Location 3:15273848-15273870 3:15273884-15273906
Sequence CCCACCCAAATTTACATATTGAA ATGTGATTATATTAGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 35, 3: 258, 4: 1547} {0: 1, 1: 6, 2: 120, 3: 666, 4: 2600}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!