ID: 950775411_950775417

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 950775411 950775417
Species Human (GRCh38) Human (GRCh38)
Location 3:15345699-15345721 3:15345737-15345759
Sequence CCGGGTGAAAATGTGTTCTAAGC TGCTCATGGGGGAATGAGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!