ID: 950780096_950780099

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 950780096 950780099
Species Human (GRCh38) Human (GRCh38)
Location 3:15384272-15384294 3:15384311-15384333
Sequence CCTCATGTGCTCAGAGCTTCCAA GCATTAAAAAAAAATATGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 207} {0: 1, 1: 0, 2: 8, 3: 161, 4: 1535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!